Copyright©2018 CSIR-Institute of Genomics and Integrative Biology | VS Lab |
hsa_circ_0001785 | |||
Gene | ELP3 | Organism | Human |
Genome Locus | chr8:28013458-28019595:+ | Build | hg19 |
Disease | Breast Cancer | ICD-10 | Malignant neoplasm of breast (C50) |
DBLink | Link to database | PMID | 29045858 |
Experimental Method | |||
Sample Type | Peripheral blood samples | Comparison | 57 patients and 17 age-matched healthy individuals |
Method for Estimation | Quantitative PCR | PCR Details | |
Primers (Experimented) | Forward CAGTTTTTGATTGCCCCTCC ReverseGTGTCGTGGGTCTAGTAACC | Statistics | Fold Change : Upregulated pvalue : p<0.05 |
Citation | |||
Yin, WB, Yan, MG, Fang, X, Guo, JJ, Xiong, W, Zhang, RP (2018). Circulating circular RNA hsa_circ_0001785 acts as a diagnostic biomarker for breast cancer detection. Clin. Chim. Acta, 487:363-368. |