circad | circRNAs associated with diseases

hsa_circ_0001785
Gene	ELP3	Organism	Human
Genome Locus	chr8:28013458-28019595:+	Build	hg19
Disease	Breast Cancer	ICD-10	Malignant neoplasm of breast (C50)
DBLink	Link to database	PMID	29045858
Experimental Method
Sample Type	Peripheral blood samples	Comparison	57 patients and 17 age-matched healthy individuals
Method for Estimation	Quantitative PCR	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward CAGTTTTTGATTGCCCCTCC Reverse GTGTCGTGGGTCTAGTAACC	Statistics	Fold Change : Upregulated pvalue : p<0.05
Citation
Yin, WB, Yan, MG, Fang, X, Guo, JJ, Xiong, W, Zhang, RP (2018). Circulating circular RNA hsa_circ_0001785 acts as a diagnostic biomarker for breast cancer detection. Clin. Chim. Acta, 487:363-368.